Stem-loop sequence hsa-mir-4678

AccessionMI0017309 (change log)
Symbol HGNC:MIR4678
DescriptionHomo sapiens miR-4678 stem-loop
Stem-loop
   -ggaaaaaaca    -          --   a     u 
5'            aggu auuguucaga  cuu ugauu u
              |||| ||||||||||  ||| ||||| u
3'            ucca uaacgagucu  gaa acugg g
   ccaaaaaauua    a          ua   -     g 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 87503881-87503954 [+]
antisense
OTTHUMT00000049148 ; GRID1-002; intron 8
OTTHUMT00000049147 ; GRID1-001; intron 8
ENST00000536331 ; GRID1-201; intron 1
ENST00000327946 ; GRID1-002; intron 8
ENST00000464741 ; GRID1-001; intron 8
Database links

Mature sequence hsa-miR-4678

Accession MIMAT0019762
Sequence

10 - 

aagguauuguucagacuuauga

 - 31

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).