Stem-loop sequence hsa-mir-4677

AccessionMI0017308 (change log)
Symbol HGNC:MIR4677
DescriptionHomo sapiens miR-4677 stem-loop
Gene family MIPF0001848; mir-4677
Stem-loop
     a      caauu             u   c  u  ccu 
5' gc aagcag     guucuuuggucuu cag ca ga   g
   || ||||||     ||||||||||||| ||| || ||    
3' cg uucguu     caagaaaccagag guc gu cu   a
     g      -ucau             u   u  -  ucc 
Get sequence
Deep sequencing
1935 reads, 1.59 reads per million, 126 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 243346176-243346255 [+]
antisense
OTTHUMT00000381212 ; CEP170-025; intron 1
OTTHUMT00000096196 ; CEP170-008; intron 2
OTTHUMT00000381167 ; CEP170-022; intron 2
OTTHUMT00000096179 ; CEP170-004; intron 5
OTTHUMT00000096176 ; CEP170-001; intron 9
OTTHUMT00000096177 ; CEP170-002; intron 9
OTTHUMT00000096178 ; CEP170-003; intron 10
ENST00000522895 ; CEP170-025; intron 1
ENST00000461671 ; CEP170-008; intron 2
ENST00000521911 ; CEP170-022; intron 2
ENST00000336415 ; CEP170-004; intron 5
ENST00000366544 ; CEP170-001; intron 9
ENST00000366543 ; CEP170-002; intron 9
ENST00000366542 ; CEP170-003; intron 10
Database links

Mature sequence hsa-miR-4677-5p

Accession MIMAT0019760
Sequence

13 - 

uuguucuuuggucuuucagcca

 - 34

Get sequence
Deep sequencing225 reads, 54 experiments
Evidence experimental; Illumina [1,3]
Predicted targets

Mature sequence hsa-miR-4677-3p

Accession MIMAT0019761
Sequence

50 - 

ucugugagaccaaagaacuacu

 - 71

Get sequence
Deep sequencing1707 reads, 121 experiments
Evidence experimental; Illumina [1,3]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).
3
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).