Stem-loop sequence hsa-mir-4674

AccessionMI0017305 (change log)
Symbol HGNC:MIR4674
DescriptionHomo sapiens miR-4674 stem-loop
Literature search

3 open access papers mention hsa-mir-4674
(3 sentences)

Stem-loop
      ag  ---   -   -      -    c   g gccg     ucc 
5' ccc  gc   gcc cgc ucccga ccca gcc c    ccggg   c
   |||  ||   ||| ||| |||||| |||| ||| |    |||||   u
3' ggg  cg   cgg gcg agggcu gggu cgg g    ggccc   c
      cu  acu   c   c      c    -   a ---a     cuc 
Get sequence
Deep sequencing
137 reads, 8.33 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 136546173-136546259 [-]
sense
OTTHUMT00000054932 ; SARDH-002; intron 5
OTTHUMT00000054931 ; SARDH-001; intron 17
ENST00000371868 ; SARDH-002; intron 5
ENST00000422262 ; SARDH-202; intron 16
ENST00000371872 ; SARDH-001; intron 17
ENST00000439388 ; SARDH-203; intron 17
Database links

Mature sequence hsa-miR-4674

Accession MIMAT0019756
Sequence

58 - 

cugggcucgggacgcgcggcu

 - 78

Get sequence
Deep sequencing23 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).