Stem-loop sequence hsa-mir-4673

AccessionMI0017304 (change log)
Symbol HGNC:MIR4673
DescriptionHomo sapiens miR-4673 stem-loop
Literature search

1 open access papers mention hsa-mir-4673
(1 sentences)

Stem-loop
      -    c   a     ac   a    ag 
5' guc cagg agg gccgg  ugg ccuc  g
   ||| |||| ||| |||||  ||| ||||   
3' cgg guuc ucc cggcc  guc ggag  g
      c    -   c     ca   -    aa 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 136519568-136519626 [-]
antisense
OTTHUMT00000054929 ; DBH-001; intron 9
ENST00000393056 ; DBH-001; intron 9
Database links

Mature sequence hsa-miR-4673

Accession MIMAT0019755
Sequence

2 - 

uccaggcaggagccggacugga

 - 23

Get sequence
Deep sequencing18 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).