Stem-loop sequence hsa-mir-4672

AccessionMI0017303 (change log)
Symbol HGNC:MIR4672
DescriptionHomo sapiens miR-4672 stem-loop
Gene family MIPF0001551; mir-4672
Literature search

1 open access papers mention hsa-mir-4672
(1 sentences)

Stem-loop
        c   uc                      --uu  a 
5' ggcug uuc  gccucuguccagcuguguggcc    gg c
   ||||| |||  ||||||||||||||||||||||    || a
3' ccgac aag  cggagacaggucgacacauugg    cc a
        a   ca                      uucu  g 
Get sequence
Deep sequencing
65 reads, 46.4 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 127869415-127869495 [-]
sense
OTTHUMT00000054055 ; SCAI-001; intron 2
OTTHUMT00000356269 ; SCAI-004; intron 2
OTTHUMT00000356268 ; SCAI-003; intron 2
ENST00000336505 ; SCAI-001; intron 2
ENST00000477186 ; SCAI-004; intron 2
ENST00000373549 ; SCAI-003; intron 2
Database links

Mature sequence hsa-miR-4672

Accession MIMAT0019754
Sequence

51 - 

uuacacagcuggacagaggca

 - 71

Get sequence
Deep sequencing44 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).