Stem-loop sequence hsa-mir-4671

AccessionMI0017302 (change log)
Symbol HGNC:MIR4671
DescriptionHomo sapiens miR-4671 stem-loop
Stem-loop
         a                        - uua 
5' uauuuu agaccgaagacugugcgcuaaucu c   g
   |||||| |||||||||||||||||||||||| |    
3' auaaaa ucugguuucugauacgugauuaga g   c
         c                        a uca 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 234306467-234306539 [+]
sense
OTTHUMT00000092579 ; SLC35F3-001; intron 2
ENST00000366618 ; SLC35F3-001; intron 2
Database links

Mature sequence hsa-miR-4671-5p

Accession MIMAT0019752
Sequence

10 - 

accgaagacugugcgcuaaucu

 - 31

Get sequence
Deep sequencing12 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4671-3p

Accession MIMAT0019753
Sequence

46 - 

uuagugcauagucuuuggucu

 - 66

Get sequence
Deep sequencing16 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).