Stem-loop sequence hsa-mir-4670

AccessionMI0017301 (change log)
Symbol HGNC:MIR4670
DescriptionHomo sapiens miR-4670 stem-loop
Stem-loop
                                ca    cu 
5' cucuaggaagcgaccaugauguaacuuca  gacu  c
   |||||||||||||||||||||||||||||  ||||  c
3' gagauccuucgcugguacuacauugaagu  cuga  a
                                --    aa 
Get sequence
Deep sequencing
95 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 92527984-92528058 [-]
intergenic
Database links

Mature sequence hsa-miR-4670-5p

Accession MIMAT0019750
Sequence

8 - 

aagcgaccaugauguaacuuca

 - 29

Get sequence
Deep sequencing37 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4670-3p

Accession MIMAT0019751
Sequence

47 - 

ugaaguuacaucauggucgcuu

 - 68

Get sequence
Deep sequencing51 reads, 29 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).