Stem-loop sequence hsa-mir-4669

AccessionMI0017300 (change log)
Symbol HGNC:MIR4669
DescriptionHomo sapiens miR-4669 stem-loop
Stem-loop
      uc              c  uc      u 
5' gcc  ccuucacuuccugg ca  caggca c
   |||  |||||||||||||| ||  ||||||  
3' cgg  ggaggugaagggcc gu  gucugu u
      ga              u  --      g 
Get sequence
Deep sequencing
61 reads, 2.7 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 134379411-134379472 [+]
sense
OTTHUMT00000054741 ; POMT1-005; intron 1
OTTHUMT00000054738 ; POMT1-002; intron 1
OTTHUMT00000054737 ; POMT1-001; intron 1
OTTHUMT00000054739 ; POMT1-003; intron 1
OTTHUMT00000054745 ; POMT1-009; intron 1
OTTHUMT00000054743 ; POMT1-007; intron 1
OTTHUMT00000054742 ; POMT1-006; intron 1
OTTHUMT00000054746 ; POMT1-010; intron 1
OTTHUMT00000054744 ; POMT1-008; intron 1
ENST00000441334 ; POMT1-005; intron 1
ENST00000341012 ; POMT1-002; intron 1
ENST00000372228 ; POMT1-001; intron 1
ENST00000402686 ; POMT1-003; intron 1
ENST00000418774 ; POMT1-009; intron 1
ENST00000415075 ; POMT1-007; intron 1
ENST00000448212 ; POMT1-006; intron 1
ENST00000483472 ; POMT1-010; intron 1
ENST00000430619 ; POMT1-008; intron 1
ENST00000423007 ; POMT1-204; intron 1
ENST00000354713 ; POMT1-201; intron 1
ENST00000541219 ; POMT1-205; intron 1
ENST00000404875 ; POMT1-202; intron 1
ENST00000419118 ; POMT1-203; intron 1
Database links

Mature sequence hsa-miR-4669

Accession MIMAT0019749
Sequence

39 - 

uguguccgggaaguggaggagg

 - 60

Get sequence
Deep sequencing32 reads, 20 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).