Stem-loop sequence hsa-mir-4668

AccessionMI0017298 (change log)
Symbol HGNC:MIR4668
DescriptionHomo sapiens miR-4668 stem-loop
Literature search

6 open access papers mention hsa-mir-4668
(52 sentences)

Stem-loop
   -a       a           g    guagc   g 
5'   gggaaaa aaaaaggauuu ucuu     cag a
     ||||||| ||||||||||| ||||     |||  
3'   ccuuuuu uuuuuccuaaa agaa     guu u
   ga       g           -    auuuu   a 
Get sequence
Deep sequencing
165 reads, 0 reads per million, 82 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 111932100-111932169 [+]
intergenic
Database links

Mature sequence hsa-miR-4668-5p

Accession MIMAT0019745
Sequence

1 - 

agggaaaaaaaaaaggauuuguc

 - 23

Get sequence
Deep sequencing131 reads, 70 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4668-3p

Accession MIMAT0019746
Sequence

48 - 

gaaaauccuuuuuguuuuuccag

 - 70

Get sequence
Deep sequencing26 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).