Stem-loop sequence hsa-mir-4667

AccessionMI0017297 (change log)
Symbol HGNC:MIR4667
DescriptionHomo sapiens miR-4667 stem-loop
Gene family MIPF0001390; mir-4667
Stem-loop
   ugac      g         --aa -     aaa 
5'     ugggga cagaaggag    c ccaag   a
       |||||| |||||||||    | |||||   g
3'     accccu gucuuccuc    g gguuc   c
   -gac      -         ccug a     agu 
Get sequence
Deep sequencing
254 reads, 3.85 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 35608094-35608159 [+]
sense
OTTHUMT00000052318 ; TESK1-005; exon 2
OTTHUMT00000052317 ; TESK1-004; exon 3
OTTHUMT00000052316 ; TESK1-003; exon 4
OTTHUMT00000052315 ; TESK1-002; exon 7
OTTHUMT00000052314 ; TESK1-001; 3'UTR (exon 8)
ENST00000578933 ; MIR4667-201; exon 1
ENST00000480077 ; TESK1-005; exon 2
ENST00000463897 ; TESK1-004; exon 3
ENST00000467424 ; TESK1-003; exon 4
ENST00000498522 ; TESK1-002; exon 7
ENST00000336395 ; TESK1-001; 3'UTR (exon 8)
Database links

Mature sequence hsa-miR-4667-5p

Accession MIMAT0019743
Sequence

3 - 

acuggggagcagaaggagaacc

 - 24

Get sequence
Deep sequencing238 reads, 73 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-4667-3p

Accession MIMAT0019744
Sequence

46 - 

ucccuccuucuguccccacag

 - 66

Get sequence
Deep sequencing13 reads, 9 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).