Stem-loop sequence hsa-mir-4666b

AccessionMI0019299 (change log)
Symbol HGNC:MIR4666B
DescriptionHomo sapiens miR-4666b stem-loop
Stem-loop
   u                                gcccuu 
5'  gucuaaauugcaugucagauuguaauucccag      c
    ||||||||||||||||||||||||||||||||      c
3'  cagauuuaacguacaguuuaacauuaaggguc      u
   a                                auaacc 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 29574278-29574358 [+]
sense
OTTHUMT00000056155 ; IL1RAPL1-001; intron 5
ENST00000302196 ; IL1RAPL1-201; intron 4
ENST00000378993 ; IL1RAPL1-001; intron 5
Database links

Mature sequence hsa-miR-4666b

Accession MIMAT0022485
Sequence

9 - 

uugcaugucagauuguaauuccc

 - 31

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).