Stem-loop sequence hsa-mir-4666a

AccessionMI0017296 (change log)
Previous IDshsa-mir-4666
Symbol HGNC:MIR4666A
DescriptionHomo sapiens miR-4666a stem-loop
Literature search

1 open access papers mention hsa-mir-4666a
(1 sentences)

Stem-loop
      a                          uacaaaau 
5' auc cuuaaauacaugucagauuguaugcc        c
   ||| ||||||||||||||||||||||||||        c
3' uag gaauuuauguacagucuaacauacgg        c
      a                          ucagaccu 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 228462074-228462152 [+]
sense
OTTHUMT00000095986 ; OBSCN-001; 3'UTR (exon 19)
OTTHUMT00000421354 ; OBSCN-011; 3'UTR (exon 23)
ENST00000359599 ; OBSCN-201; 3'UTR (exon 8)
ENST00000284548 ; OBSCN-001; 3'UTR (exon 19)
ENST00000422127 ; OBSCN-204; 3'UTR (exon 19)
ENST00000366707 ; OBSCN-202; 3'UTR (exon 19)
ENST00000366709 ; OBSCN-203; 3'UTR (exon 19)
ENST00000570156 ; OBSCN-011; 3'UTR (exon 23)
antisense
OTTHUMT00000467424 ; RP5-1139B12.2-001; exon 1
ENST00000602517 ; RP5-1139B12.2-001; exon 1
Database links

Mature sequence hsa-miR-4666a-5p

Accession MIMAT0019741
Previous IDshsa-miR-4666-5p
Sequence

10 - 

auacaugucagauuguaugcc

 - 30

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4666a-3p

Accession MIMAT0019742
Previous IDshsa-miR-4666-3p
Sequence

52 - 

cauacaaucugacauguauuu

 - 72

Get sequence
Deep sequencing12 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).