Stem-loop sequence hsa-mir-4665

AccessionMI0017295 (change log)
Symbol HGNC:MIR4665
DescriptionHomo sapiens miR-4665 stem-loop
Literature search

1 open access papers mention hsa-mir-4665
(1 sentences)

Stem-loop
        g   c      --      ga   --       cuu 
5' cucga gug uggggg  acgcgu  gcg  cgagccg   c
   ||||| ||| ||||||  ||||||  |||  |||||||    
3' gggcu cac gccccc  ugcgcg  cgc  gcucggc   c
        a   c      ga      -g   cg       acu 
Get sequence
Deep sequencing
76 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 6007826-6007904 [+]
antisense
OTTHUMT00000400996 ; KIAA2026-003; 5'UTR (exon 1)
ENST00000513355 ; KIAA2026-003; 5'UTR (exon 1)
Database links

Mature sequence hsa-miR-4665-5p

Accession MIMAT0019739
Sequence

10 - 

cugggggacgcgugagcgcgagc

 - 32

Get sequence
Deep sequencing71 reads, 34 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4665-3p

Accession MIMAT0019740
Sequence

46 - 

cucggccgcggcgcguagcccccgcc

 - 71

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).