Stem-loop sequence hsa-mir-4664

AccessionMI0017294 (change log)
Symbol HGNC:MIR4664
DescriptionHomo sapiens miR-4664 stem-loop
Literature search

1 open access papers mention hsa-mir-4664
(1 sentences)

Stem-loop
   guu     c      gcc   --u   c     -a    
5'    ggggg uggggu   cac   ccg aaguu  uca 
      ||||| ||||||   |||   ||| |||||  || c
3'    ccucc gccccg   gug   ggc uucag  agu 
   -cg     u      --a   ucu   c     cg    
Get sequence
Deep sequencing
210 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 143733083-143733153 [-]
intergenic
Database links

Mature sequence hsa-miR-4664-5p

Accession MIMAT0019737
Sequence

10 - 

uggggugcccacuccgcaaguu

 - 31

Get sequence
Deep sequencing173 reads, 52 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4664-3p

Accession MIMAT0019738
Sequence

44 - 

cuuccggucugugagccccguc

 - 65

Get sequence
Deep sequencing31 reads, 28 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).