Stem-loop sequence hsa-mir-4663

AccessionMI0017292 (change log)
Symbol HGNC:MIR4663
DescriptionHomo sapiens miR-4663 stem-loop
Stem-loop
      ug u  ag          u   -c  -        a 
5' cug  g gg  cugagcucca gga  gu gcaguggc u
   |||  | ||  |||||||||| |||  || ||||||||  
3' gac  u cc  gacucgaggu ccu  cg cguuacug c
      gu c  -g          -   uc  u        u 
Get sequence
Deep sequencing
31 reads, 110 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 123215788-123215863 [-]
intergenic
Database links

Mature sequence hsa-miR-4663

Accession MIMAT0019735
Sequence

10 - 

agcugagcuccauggacgugcagu

 - 33

Get sequence
Deep sequencing10 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).