Stem-loop sequence hsa-mir-4662b

AccessionMI0017293 (change log)
Symbol HGNC:MIR4662B
DescriptionHomo sapiens miR-4662b stem-loop
Gene family MIPF0001245; mir-4662
Stem-loop
       a u                           gcauu 
5' caca u ucuauuuagccaauugucuaucuuuag     c
   |||| | |||||||||||||||||||||||||||     a
3' gugu a agauaaaucgguuaacagguagaaauc     g
       c c                           gauaa 
Get sequence
Deep sequencing
314 reads, 1.35 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 124821978-124822058 [-]
antisense
OTTHUMT00000381350 ; FAM91A1-006; intron 1
OTTHUMT00000381351 ; FAM91A1-008; intron 1
OTTHUMT00000381352 ; FAM91A1-007; intron 1
OTTHUMT00000381345 ; FAM91A1-004; intron 22
OTTHUMT00000256607 ; FAM91A1-001; intron 22
OTTHUMT00000381347 ; FAM91A1-003; intron 22
ENST00000518333 ; FAM91A1-006; intron 1
ENST00000518976 ; FAM91A1-008; intron 1
ENST00000520246 ; FAM91A1-007; intron 1
ENST00000521166 ; FAM91A1-004; intron 22
ENST00000334705 ; FAM91A1-001; intron 22
ENST00000519721 ; FAM91A1-003; intron 22
Clustered miRNAs
< 10kb from hsa-mir-4662b
hsa-mir-4662achr8: 124821985-124822051 [+]
hsa-mir-4662bchr8: 124821978-124822058 [-]
Database links

Mature sequence hsa-miR-4662b

Accession MIMAT0019736
Sequence

50 - 

aaagauggacaauuggcuaaau

 - 71

Get sequence
Deep sequencing75 reads, 43 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).