Stem-loop sequence hsa-mir-4662a

AccessionMI0017290 (change log)
Symbol HGNC:MIR4662A
DescriptionHomo sapiens miR-4662a stem-loop
Gene family MIPF0001245; mir-4662
Stem-loop
                     c        c   u 
5' ucuauuuagccaauuguc aucuuuag uau c
   |||||||||||||||||| |||||||| ||| u
3' agauaaaucgguuaacag uagaaauc gua g
                     a        c   a 
Get sequence
Deep sequencing
446 reads, 2.27 reads per million, 88 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 124821985-124822051 [+]
sense
OTTHUMT00000381350 ; FAM91A1-006; intron 1
OTTHUMT00000381351 ; FAM91A1-008; intron 1
OTTHUMT00000381352 ; FAM91A1-007; intron 1
OTTHUMT00000381345 ; FAM91A1-004; intron 22
OTTHUMT00000256607 ; FAM91A1-001; intron 22
OTTHUMT00000381347 ; FAM91A1-003; intron 22
ENST00000518333 ; FAM91A1-006; intron 1
ENST00000518976 ; FAM91A1-008; intron 1
ENST00000520246 ; FAM91A1-007; intron 1
ENST00000521166 ; FAM91A1-004; intron 22
ENST00000334705 ; FAM91A1-001; intron 22
ENST00000519721 ; FAM91A1-003; intron 22
Clustered miRNAs
< 10kb from hsa-mir-4662a
hsa-mir-4662bchr8: 124821978-124822058 [-]
hsa-mir-4662achr8: 124821985-124822051 [+]
Database links

Mature sequence hsa-miR-4662a-5p

Accession MIMAT0019731
Sequence

6 - 

uuagccaauuguccaucuuuag

 - 27

Get sequence
Deep sequencing352 reads, 80 experiments
Evidence experimental; Illumina [1,3]
Database links
Predicted targets

Mature sequence hsa-miR-4662a-3p

Accession MIMAT0019732
Sequence

43 - 

aaagauagacaauuggcuaaau

 - 64

Get sequence
Deep sequencing92 reads, 50 experiments
Evidence experimental; Illumina [1,3]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).
3
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).