Stem-loop sequence hsa-mir-4661

AccessionMI0017289 (change log)
Symbol HGNC:MIR4661
DescriptionHomo sapiens miR-4661 stem-loop
Literature search

2 open access papers mention hsa-mir-4661
(2 sentences)

Stem-loop
   u        a                   ----a   a 
5'  uuacucug acuagcucuguggauccug     cag c
    |||||||| |||||||||||||||||||     ||| a
3'  aaugagac ugaucgagacaccuaggac     guc g
   a        c                   agaua   c 
Get sequence
Deep sequencing
259 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 91205485-91205559 [+]
intergenic
Database links

Mature sequence hsa-miR-4661-5p

Accession MIMAT0019729
Sequence

10 - 

aacuagcucuguggauccugac

 - 31

Get sequence
Deep sequencing211 reads, 29 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4661-3p

Accession MIMAT0019730
Sequence

47 - 

caggauccacagagcuagucca

 - 68

Get sequence
Deep sequencing45 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).