Stem-loop sequence hsa-mir-4660

AccessionMI0017288 (change log)
Symbol HGNC:MIR4660
DescriptionHomo sapiens miR-4660 stem-loop
Gene family MIPF0001460; mir-4660
Stem-loop
        u  ugca       u   aa      --   ac 
5' acucc uc    gcucugg gga  auggag  aag  u
   ||||| ||    ||||||| |||  ||||||  |||  u
3' ugagg gg    cgggacc ccu  uaccuc  uuc  u
        u  --uc       c   -c      cu   cu 
Get sequence
Deep sequencing
202 reads, 22.5 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 9048445-9048518 [+]
sense
OTTHUMT00000374699 ; RP11-10A14.5-003; intron 1
OTTHUMT00000374700 ; RP11-10A14.5-002; intron 1
OTTHUMT00000374698 ; RP11-10A14.5-001; intron 2
ENST00000417333 ; RP11-10A14.5-003; intron 1
ENST00000523747 ; RP11-10A14.5-002; intron 1
ENST00000512942 ; RP11-10A14.5-001; intron 2
Database links

Mature sequence hsa-miR-4660

Accession MIMAT0019728
Sequence

9 - 

ugcagcucugguggaaaauggag

 - 31

Get sequence
Deep sequencing164 reads, 45 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).