Stem-loop sequence hsa-mir-466

AccessionMI0014157 (change log)
Symbol HGNC:MIR466
DescriptionHomo sapiens miR-466 stem-loop
Gene family MIPF0000316; mir-467
Literature search

18 open access papers mention hsa-mir-466
(46 sentences)

Stem-loop
                        a       a        uau 
5' guguguguauauguguguugc ugugugu uaugugug   a
   ||||||||||||||||||||| ||||||| ||||||||    
3' cguacauauauacacacaacg acauaca auacacau   u
                        c       c        gua 
Get sequence
Deep sequencing
513 reads, 13.3 reads per million, 83 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 31161704-31161787 [-]
intergenic
Database links

Mature sequence hsa-miR-466

Accession MIMAT0015002
Sequence

52 - 

auacacauacacgcaacacacau

 - 74

Get sequence
Deep sequencing65 reads, 32 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).