Stem-loop sequence hsa-mir-4659b

AccessionMI0017291 (change log)
Symbol HGNC:MIR4659B
DescriptionHomo sapiens miR-4659b stem-loop
Gene family MIPF0001256; mir-4659
Stem-loop
          c                          u 
5' cuguuga guugccaugucuaagaagaaaauuuu c
   ||||||| |||||||||||||||||||||||||| u
3' gacgacu cgacgguacagauucuucuuuugaaa c
          u                          c 
Get sequence
Deep sequencing
189 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 6745168-6745240 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-4659b
hsa-mir-4659bchr8: 6745168-6745240 [-]
hsa-mir-4659achr8: 6745164-6745244 [+]
Database links

Mature sequence hsa-miR-4659b-5p

Accession MIMAT0019733
Sequence

10 - 

uugccaugucuaagaagaa

 - 28

Get sequence
Deep sequencing22 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4659b-3p

Accession MIMAT0019734
Sequence

45 - 

uuucuucuuagacauggcagcu

 - 66

Get sequence
Deep sequencing158 reads, 57 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).