Stem-loop sequence hsa-mir-4659a

AccessionMI0017287 (change log)
Symbol HGNC:MIR4659A
DescriptionHomo sapiens miR-4659a stem-loop
Gene family MIPF0001256; mir-4659
Literature search

1 open access papers mention hsa-mir-4659a
(1 sentences)

Stem-loop
          c   a c                    c   g 
5' gaaacug uga g ugccaugucuaagaagaaaa uuu g
   ||||||| ||| | |||||||||||||||||||| ||| a
3' cuuugac acu c acgguacagauucuucuuuu aaa g
          a   g a                    a   a 
Get sequence
Deep sequencing
202 reads, 2.7 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 6745164-6745244 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-4659a
hsa-mir-4659achr8: 6745164-6745244 [+]
hsa-mir-4659bchr8: 6745168-6745240 [-]
Database links

Mature sequence hsa-miR-4659a-5p

Accession MIMAT0019726
Sequence

14 - 

cugccaugucuaagaagaaaac

 - 35

Get sequence
Deep sequencing27 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4659a-3p

Accession MIMAT0019727
Sequence

49 - 

uuucuucuuagacauggcaacg

 - 70

Get sequence
Deep sequencing169 reads, 62 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).