Stem-loop sequence hsa-mir-4658

AccessionMI0017286 (change log)
Symbol HGNC:MIR4658
DescriptionHomo sapiens miR-4658 stem-loop
Stem-loop
     ug cc   a   ag  c        c   u 
5' gc  c  uuc cuc  ag aucuacac cac a
   ||  |  ||| |||  || |||||||| ||| c
3' cg  g  aag gag  uc uaggugug gug c
     gu cu   -   -g  c        a   g 
Get sequence
Deep sequencing
125 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 100156605-100156669 [-]
antisense
OTTHUMT00000342773 ; AGFG2-005; intron 2
OTTHUMT00000342772 ; AGFG2-004; intron 4
OTTHUMT00000342771 ; AGFG2-003; intron 4
OTTHUMT00000342769 ; AGFG2-001; intron 6
ENST00000429987 ; AGFG2-005; intron 2
ENST00000430857 ; AGFG2-004; intron 4
ENST00000474713 ; AGFG2-003; intron 4
ENST00000262935 ; AGFG2-201; intron 4
ENST00000300176 ; AGFG2-001; intron 6
Database links

Mature sequence hsa-miR-4658

Accession MIMAT0019725
Sequence

37 - 

gugaguguggauccuggaggaau

 - 59

Get sequence
Deep sequencing121 reads, 45 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).