Stem-loop sequence hsa-mir-4656

AccessionMI0017284 (change log)
Symbol HGNC:MIR4656
DescriptionHomo sapiens miR-4656 stem-loop
Stem-loop
         -  g      g   --            u  c 
5' aggcug gc ugggcu agg  gcaggaggccug gg c
   |||||| || |||||| |||  |||||||||||| || g
3' uuuggc cg acucgg ucc  cguccuccggac cc g
         u  g      g   uu            -  u 
Get sequence
Deep sequencing
136 reads, 12 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 4788565-4788639 [-]
antisense
OTTHUMT00000323770 ; FOXK1-002; intron 1
OTTHUMT00000323729 ; FOXK1-001; intron 2
ENST00000460979 ; FOXK1-002; intron 1
ENST00000328914 ; FOXK1-001; intron 2
ENST00000446823 ; FOXK1-201; intron 5
Database links

Mature sequence hsa-miR-4656

Accession MIMAT0019723
Sequence

10 - 

ugggcugagggcaggaggccugu

 - 32

Get sequence
Deep sequencing51 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).