Stem-loop sequence hsa-mir-4654

AccessionMI0017282 (change log)
Symbol HGNC:MIR4654
DescriptionHomo sapiens miR-4654 stem-loop
Gene family MIPF0001507; mir-4654
Literature search

3 open access papers mention hsa-mir-4654
(7 sentences)

Stem-loop
        u   --  u    ucu      auc       gg 
5' cuggc ggu  ug ggga   ggaggc   ugggguu  a
   ||||| |||  || ||||   ||||||   |||||||  a
3' gaccg cua  ac cccu   ccucug   accccag  u
        u   cu  u    uuu      ---       ug 
Get sequence
Deep sequencing
184 reads, 0 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 162157107-162157182 [+]
sense
OTTHUMT00000382762 ; NOS1AP-008; intron 2
OTTHUMT00000060555 ; NOS1AP-001; intron 2
OTTHUMT00000382763 ; NOS1AP-009; intron 2
ENST00000530878 ; NOS1AP-008; intron 2
ENST00000361897 ; NOS1AP-001; intron 2
ENST00000430120 ; NOS1AP-009; intron 2
Database links

Mature sequence hsa-miR-4654

Accession MIMAT0019720
Sequence

10 - 

ugugggaucuggaggcaucugg

 - 31

Get sequence
Deep sequencing174 reads, 45 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).