Stem-loop sequence hsa-mir-4653

AccessionMI0017281 (change log)
Symbol HGNC:MIR4653
DescriptionHomo sapiens miR-4653 stem-loop
Literature search

1 open access papers mention hsa-mir-4653
(1 sentences)

Stem-loop
   u g          ug     gg      a   aa    uaa 
5'  u uccaauucuc  agcaa  cuuaac cca  gggu   g
    | ||||||||||  |||||  |||||| |||  ||||   g
3'  a agguuaagag  ucguu  gaauug ggu  cucg   g
   a g          gu     gg      a   --    uuu 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 101159473-101159555 [+]
sense
OTTHUMT00000315898 ; EMID2-002; intron 3
OTTHUMT00000315897 ; EMID2-001; intron 3
ENST00000397927 ; COL26A1-002; intron 3
ENST00000528707 ; COL26A1-001; intron 3
ENST00000313669 ; COL26A1-201; intron 3
Database links

Mature sequence hsa-miR-4653-5p

Accession MIMAT0019718
Sequence

10 - 

ucucugagcaaggcuuaacacc

 - 31

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4653-3p

Accession MIMAT0019719
Sequence

52 - 

uggaguuaaggguugcuuggaga

 - 74

Get sequence
Deep sequencing10 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).