Stem-loop sequence hsa-mir-4652

AccessionMI0017280 (change log)
Symbol HGNC:MIR4652
DescriptionHomo sapiens miR-4652 stem-loop
Literature search

1 open access papers mention hsa-mir-4652
(3 sentences)

Stem-loop
          c       cu            uaacuaacc 
5' uauugga gagggga  gguuaauagaac         a
   ||||||| |||||||  ||||||||||||          
3' auaaucu cuccccu  ccaauugucuug         g
          a       ac            uuuuaucaa 
Get sequence
Deep sequencing
218 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 93716928-93717005 [+]
intergenic
Database links

Mature sequence hsa-miR-4652-5p

Accession MIMAT0019716
Sequence

10 - 

aggggacugguuaauagaacua

 - 31

Get sequence
Deep sequencing145 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4652-3p

Accession MIMAT0019717
Sequence

50 - 

guucuguuaacccauccccuca

 - 71

Get sequence
Deep sequencing23 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
3
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).