Stem-loop sequence hsa-mir-4651

AccessionMI0017279 (change log)
Symbol HGNC:MIR4651
DescriptionHomo sapiens miR-4651 stem-loop
Literature search

2 open access papers mention hsa-mir-4651
(3 sentences)

Stem-loop
       ga   c   g  -    --a  u        aa 
5' cggc  cgg ggg ug ggug   gg cgggcccc  g
   ||||  ||| ||| || ||||   || ||||||||  a
3' gccg  gcc cuu ac ccgc   cc guuugggg  c
       gc   a   g  u    ggg  -        cu 
Get sequence
Deep sequencing
132 reads, 5 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 75915197-75915269 [+]
sense
OTTHUMT00000344671 ; SRRM3-003; exon 4
OTTHUMT00000252889 ; SRRM3-001; exon 15
ENST00000413003 ; SRRM3-003; exon 4
ENST00000326382 ; SRRM3-001; exon 15
ENST00000388802 ; SRRM3-201; exon 16
Database links

Mature sequence hsa-miR-4651

Accession MIMAT0019715
Sequence

10 - 

cggggugggugaggucgggc

 - 29

Get sequence
Deep sequencing129 reads, 38 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).