Stem-loop sequence hsa-mir-4650-1

AccessionMI0017277 (change log)
Symbol HGNC:MIR4650-1
DescriptionHomo sapiens miR-4650-1 stem-loop
Gene family MIPF0001234; mir-4650
Literature search

1 open access papers mention hsa-mir-4650-1
(1 sentences)

Stem-loop
            gauua         u          caa 
5' uucuguaga     ucaggccuc uucuaccuuc   g
   |||||||||     ||||||||| ||||||||||   g
3' aggacgucu     aguccggag aagauggaag   c
            -auac         u          acu 
Get sequence
Deep sequencing
52 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 67114322-67114397 [-]
intergenic
Database links

Mature sequence hsa-miR-4650-5p

Accession MIMAT0019713
Sequence

15 - 

ucaggccucuuucuaccuu

 - 33

Get sequence
Deep sequencing16 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4650-3p

Accession MIMAT0019714
Sequence

46 - 

agguagaaugaggccugacau

 - 66

Get sequence
Deep sequencing82 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).