Stem-loop sequence hsa-mir-4648

AccessionMI0017275 (change log)
Symbol HGNC:MIR4648
DescriptionHomo sapiens miR-4648 stem-loop
Stem-loop
   ----------------ugugggacugcaaa    -a  uca  a 
5'                               uggg  gc   gc c
                                 ||||  ||   ||  
3'                               accc  cg   cg c
   gacacccuugucucguccccgaccagacgc    ac  -uc  u 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 2527074-2527145 [+]
intergenic
Database links

Mature sequence hsa-miR-4648

Accession MIMAT0019710
Sequence

1 - 

ugugggacugcaaaugggag

 - 20

Get sequence
Deep sequencing15 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).