Stem-loop sequence hsa-mir-4646

AccessionMI0017273 (change log)
Symbol HGNC:MIR4646
DescriptionHomo sapiens miR-4646 stem-loop
Literature search

1 open access papers mention hsa-mir-4646
(1 sentences)

Stem-loop
   a        a   gcu        u  cg   a 
5'  cugggaag gga   gagggaca ug  gag g
    |||||||| |||   |||||||| ||  ||| g
3'  gacccuuc ccu   cucccugu ac  cuc g
   -        -   ---        u  -a   u 
Get sequence
Deep sequencing
87 reads, 0 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 31701029-31701091 [-]
sense
OTTHUMT00000076166 ; CLIC1-001; intron 4
OTTHUMT00000076168 ; CLIC1-004; intron 5
OTTHUMT00000076167 ; CLIC1-002; intron 5
OTTHUMT00000076172 ; CLIC1-003; intron 6
ENST00000375784 ; CLIC1-001; intron 4
ENST00000375779 ; CLIC1-004; intron 5
ENST00000375780 ; CLIC1-002; intron 5
ENST00000395892 ; CLIC1-003; intron 6
Database links

Mature sequence hsa-miR-4646-5p

Accession MIMAT0019707
Sequence

1 - 

acugggaagaggagcugaggga

 - 22

Get sequence
Deep sequencing44 reads, 24 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-4646-3p

Accession MIMAT0019708
Sequence

43 - 

auugucccucucccuucccag

 - 63

Get sequence
Deep sequencing22 reads, 21 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).