Stem-loop sequence hsa-mir-4645

AccessionMI0017272 (change log)
Symbol HGNC:MIR4645
DescriptionHomo sapiens miR-4645 stem-loop
Stem-loop
   u                     a         c  aa 
5'  gauagggaaaccaggcaagaa uauugucuc uc  g
    ||||||||||||||||||||| ||||||||| ||  u
3'  cuaucucuuugguccguucuu augacagag ag  u
   a                     g         c  cg 
Get sequence
Deep sequencing
147 reads, 0 reads per million, 62 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 2854031-2854107 [-]
intergenic
Database links

Mature sequence hsa-miR-4645-5p

Accession MIMAT0019705
Sequence

11 - 

accaggcaagaaauauugu

 - 29

Get sequence
Deep sequencing17 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4645-3p

Accession MIMAT0019706
Sequence

47 - 

agacaguaguucuugccugguu

 - 68

Get sequence
Deep sequencing129 reads, 57 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).