Stem-loop sequence hsa-mir-4644

AccessionMI0017271 (change log)
Symbol HGNC:MIR4644
DescriptionHomo sapiens miR-4644 stem-loop
Literature search

4 open access papers mention hsa-mir-4644
(4 sentences)

Stem-loop
        g  g  -   c      -   ca     -c   gucc 
5' gcggc gu cu cug cucuuu cuc  uccac  cug    a
   ||||| || || ||| |||||| |||  |||||  |||    g
3' ugccg ua ga gac gagaaa gag  aggug  gac    g
        g  g  a   a      a   ag     ac   accu 
Get sequence
Deep sequencing
125 reads, 5.26 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 170330761-170330844 [+]
intergenic
Database links

Mature sequence hsa-miR-4644

Accession MIMAT0019704
Sequence

53 - 

uggagagagaaaagagacagaag

 - 75

Get sequence
Deep sequencing96 reads, 38 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).