Stem-loop sequence hsa-mir-4643

AccessionMI0017270 (change log)
Symbol HGNC:MIR4643
DescriptionHomo sapiens miR-4643 stem-loop
Literature search

1 open access papers mention hsa-mir-4643
(1 sentences)

Stem-loop
         cc          aa             cacau 
5' gugugc  uagcauuuau  ucauguguucauu     g
   ||||||  ||||||||||  |||||||||||||      
3' cacacg  aucguaaaua  aguacacagguga     a
         aa          cc             auacu 
Get sequence
Deep sequencing
42 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 91521660-91521737 [+]
intergenic
Database links

Mature sequence hsa-miR-4643

Accession MIMAT0019703
Sequence

50 - 

gacacaugaccauaaaugcuaa

 - 71

Get sequence
Deep sequencing32 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).