Stem-loop sequence hsa-mir-4642

AccessionMI0017269 (change log)
Symbol HGNC:MIR4642
DescriptionHomo sapiens miR-4642 stem-loop
Stem-loop
            a          cc   -      --     cua 
5' cacaacugc uggcaucguc  cug guggcu  guggc   g
   ||||||||| ||||||||||  ||| ||||||  |||||   g
3' guguugacg accguaguag  gac caccga  caccg   g
            -          -u   u      aa     aac 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 44435641-44435722 [+]
intergenic
Database links

Mature sequence hsa-miR-4642

Accession MIMAT0019702
Sequence

10 - 

auggcaucguccccugguggcu

 - 31

Get sequence
Deep sequencing20 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).