Stem-loop sequence hsa-mir-4640

AccessionMI0017267 (change log)
Symbol HGNC:MIR4640
DescriptionHomo sapiens miR-4640 stem-loop
Literature search

3 open access papers mention hsa-mir-4640
(8 sentences)

Stem-loop
   cugugggc               cu           agua  a   g 
5'         ugggccagggagcag  gguggguggga    ag ucu a
           |||||||||||||||  |||||||||||    || ||| c
3'         acccgguccuuuguc  ccacccacccu    uc agg c
   -----gac               cc           -acc  -   u 
Get sequence
Deep sequencing
145 reads, 3.92 reads per million, 51 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 30890883-30890972 [+]
sense
OTTHUMT00000257815 ; VARS2-011; exon 3
OTTHUMT00000257808 ; VARS2-004; exon 12
OTTHUMT00000257807 ; VARS2-003; exon 13
OTTHUMT00000076566 ; VARS2-001; 3'UTR (exon 23)
OTTHUMT00000076565 ; VARS2-002; exon 35
ENST00000477052 ; VARS2-011; exon 3
ENST00000476162 ; VARS2-004; exon 12
ENST00000469358 ; VARS2-003; exon 13
ENST00000321897 ; VARS2-001; 3'UTR (exon 23)
ENST00000542001 ; VARS2-203; 3'UTR (exon 23)
ENST00000541562 ; VARS2-202; 3'UTR (exon 24)
ENST00000416670 ; VARS2-201; 3'UTR (exon 24)
ENST00000477288 ; VARS2-002; exon 35
Database links

Mature sequence hsa-miR-4640-5p

Accession MIMAT0019699
Sequence

9 - 

ugggccagggagcagcugguggg

 - 31

Get sequence
Deep sequencing90 reads, 32 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4640-3p

Accession MIMAT0019700
Sequence

67 - 

cacccccuguuuccuggcccac

 - 88

Get sequence
Deep sequencing44 reads, 24 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).