Stem-loop sequence hsa-mir-4639

AccessionMI0017266 (change log)
Symbol HGNC:MIR4639
DescriptionHomo sapiens miR-4639 stem-loop
Literature search

1 open access papers mention hsa-mir-4639
(7 sentences)

Stem-loop
   u   u       c     u   uguca      ccc 
5'  ugc aaguagg ugaga uga     gguuau   c
    ||| ||||||| ||||| |||     ||||||    
3'  acg uucguuc acucu acu     ccaaua   a
   g   u       c     c   -----      cga 
Get sequence
Deep sequencing
107 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 16141556-16141624 [+]
sense
OTTHUMT00000043865 ; MYLIP-002; intron 1
OTTHUMT00000043864 ; MYLIP-001; intron 2
ENST00000349606 ; MYLIP-002; intron 1
ENST00000356840 ; MYLIP-001; intron 2
Database links

Mature sequence hsa-miR-4639-5p

Accession MIMAT0019697
Sequence

1 - 

uugcuaaguaggcugagauuga

 - 22

Get sequence
Deep sequencing87 reads, 49 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4639-3p

Accession MIMAT0019698
Sequence

48 - 

ucacucucaccuugcuuugc

 - 67

Get sequence
Deep sequencing20 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).