Stem-loop sequence hsa-mir-4638

AccessionMI0017265 (change log)
Symbol HGNC:MIR4638
DescriptionHomo sapiens miR-4638 stem-loop
Literature search

1 open access papers mention hsa-mir-4638
(1 sentences)

Stem-loop
        -g        -  acaa uc   -c       
5' gacuc  gcugcggu gg    g  cgg  uccaga 
   |||||  |||||||| ||    |  |||  ||||| a
3' cuggg  cggcgccg cc    c  gcc  aggucc 
        ga        g  --ga uc   ac       
Get sequence
Deep sequencing
170 reads, 1.82 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 181222566-181222633 [-]
intergenic
Database links

Mature sequence hsa-miR-4638-5p

Accession MIMAT0019695
Sequence

2 - 

acucggcugcgguggacaagu

 - 22

Get sequence
Deep sequencing45 reads, 25 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4638-3p

Accession MIMAT0019696
Sequence

35 - 

ccuggacaccgcucagccggccg

 - 57

Get sequence
Deep sequencing119 reads, 43 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).