Stem-loop sequence hsa-mir-4637

AccessionMI0017264 (change log)
Symbol HGNC:MIR4637
DescriptionHomo sapiens miR-4637 stem-loop
Gene family MIPF0001586; mir-4637
Stem-loop
                     a        uu  ucaua     u 
5' cccuuacuuggaucugca uuaguauu  aa     gauug a
   |||||||||||||||||| ||||||||  ||     |||||  
3' gggagugaacuuagacgu aaucauaa  uu     uugau u
                     c        uu  --uga     u 
Get sequence
Deep sequencing
50 reads, 0 reads per million, 26 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 14825929-14826012 [-]
sense
OTTHUMT00000207063 ; ANKH-001; intron 1
OTTHUMT00000366144 ; ANKH-003; intron 1
ENST00000284268 ; ANKH-001; intron 1
ENST00000513115 ; ANKH-003; intron 1
Database links

Mature sequence hsa-miR-4637

Accession MIMAT0019694
Sequence

60 - 

uacuaacugcagauucaaguga

 - 81

Get sequence
Deep sequencing44 reads, 24 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
2
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).