Stem-loop sequence hsa-mir-4636

AccessionMI0017263 (change log)
Symbol HGNC:MIR4636
DescriptionHomo sapiens miR-4636 stem-loop
Stem-loop
                      ca           ------   g 
5' uagauucagaacucguguu  aagccuuuagc      cca c
   |||||||||||||||||||  |||||||||||      |||  
3' aucuaagucuugagcacga  uucggaaaucg      ggu a
                      ac           ugagag   a 
Get sequence
Deep sequencing
543 reads, 0 reads per million, 97 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 9053816-9053895 [-]
sense
OTTHUMT00000206989 ; SEMA5A-001; intron 19
ENST00000382496 ; SEMA5A-001; intron 19
Database links

Mature sequence hsa-miR-4636

Accession MIMAT0019693
Sequence

10 - 

aacucguguucaaagccuuuag

 - 31

Get sequence
Deep sequencing422 reads, 90 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).