Stem-loop sequence hsa-mir-4633

AccessionMI0017260 (change log)
Symbol HGNC:MIR4633
DescriptionHomo sapiens miR-4633 stem-loop
Literature search

2 open access papers mention hsa-mir-4633
(2 sentences)

Stem-loop
   u   aa u   c                          aa 
5'  ggc  g cuc gcauaugccuggcuagcuccuccaca  u
    |||  | ||| ||||||||||||||||||||||||||   
3'  cug  c gag cguauacggaccgaucgaggaggugu  g
   a   -- -   a                          gc 
Get sequence
Deep sequencing
310 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 129097688-129097766 [+]
sense
OTTHUMT00000371450 ; KIAA1024L-001; intron 2
ENST00000334562 ; KIAA1024L-201; intron 1
ENST00000564719 ; KIAA1024L-001; intron 2
antisense
OTTHUMT00000371451 ; CTC-575N7.1-001; intron 3
ENST00000503616 ; CTC-575N7.1-001; intron 3
Database links

Mature sequence hsa-miR-4633-5p

Accession MIMAT0019689
Sequence

15 - 

auaugccuggcuagcuccuc

 - 34

Get sequence
Deep sequencing257 reads, 34 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4633-3p

Accession MIMAT0019690
Sequence

50 - 

aggagcuagccaggcauaugca

 - 71

Get sequence
Deep sequencing49 reads, 27 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).