Stem-loop sequence hsa-mir-4632

AccessionMI0017259 (change log)
Symbol HGNC:MIR4632
DescriptionHomo sapiens miR-4632 stem-loop
Stem-loop
   -g         u   u        -  -  g 
5'   agggcagcg ggg guggcgga gg ca g
     ||||||||| ||| |||||||| || ||  
3'   ucucgucgc cuc cgccguuu cc gu c
   ga         u   c        g  a  g 
Get sequence
Deep sequencing
45 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 12191713-12191773 [+]
sense
OTTHUMT00000005131 ; TNFRSF8-002; intron 2
OTTHUMT00000367704 ; TNFRSF8-004; intron 2
OTTHUMT00000367703 ; TNFRSF8-003; intron 11
OTTHUMT00000005130 ; TNFRSF8-001; intron 12
ENST00000413146 ; TNFRSF8-002; intron 2
ENST00000479933 ; TNFRSF8-004; intron 2
ENST00000514649 ; TNFRSF8-003; intron 11
ENST00000417814 ; TNFRSF8-201; intron 11
ENST00000263932 ; TNFRSF8-001; intron 12
Database links

Mature sequence hsa-miR-4632-5p

Accession MIMAT0022977
Sequence

1 - 

gagggcagcguggguguggcgga

 - 23

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-4632-3p

Accession MIMAT0019688
Previous IDshsa-miR-4632
Sequence

40 - 

ugccgcccucucgcugcucuag

 - 61

Get sequence
Deep sequencing38 reads, 27 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).