Stem-loop sequence hsa-mir-4539

AccessionMI0016910 (change log)
Symbol HGNC:MIR4539
DescriptionHomo sapiens miR-4539 stem-loop
Stem-loop
   -----------------ug    g         gu    
5'                    agcu agcucugcu  gcu 
                      |||| |||||||||  || g
3'                    ucga ucgggacga  cgu 
   cgggucgagucgggucaag    g         gu    
Get sequence
Deep sequencing
59 reads, 8 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 105857513-105857572 [-]
antisense
OTTHUMT00000409219 ; PACS2-013; exon 1
OTTHUMT00000409218 ; PACS2-010; exon 2
OTTHUMT00000409217 ; PACS2-004; 3'UTR (exon 5)
OTTHUMT00000409216 ; PACS2-011; exon 8
OTTHUMT00000409215 ; PACS2-005; exon 14
OTTHUMT00000409211 ; PACS2-006; 3'UTR (exon 19)
OTTHUMT00000409208 ; PACS2-002; 3'UTR (exon 20)
OTTHUMT00000409209 ; PACS2-003; 3'UTR (exon 20)
OTTHUMT00000409210 ; PACS2-001; 3'UTR (exon 21)
ENST00000548796 ; PACS2-013; exon 1
ENST00000549030 ; PACS2-010; exon 2
ENST00000551743 ; PACS2-004; 3'UTR (exon 5)
ENST00000547903 ; PACS2-011; exon 8
ENST00000551692 ; PACS2-005; exon 14
ENST00000547217 ; PACS2-006; 3'UTR (exon 19)
ENST00000430725 ; PACS2-002; 3'UTR (exon 20)
ENST00000325438 ; PACS2-003; 3'UTR (exon 20)
ENST00000447393 ; PACS2-201; 3'UTR (exon 20)
ENST00000458164 ; PACS2-001; 3'UTR (exon 21)
Clustered miRNAs
< 10kb from hsa-mir-4539
hsa-mir-4537chr14: 105859484-105859553 [-]
hsa-mir-4538chr14: 105858165-105858242 [-]
hsa-mir-4507chr14: 105858124-105858175 [-]
hsa-mir-4539chr14: 105857513-105857572 [-]
Database links

Mature sequence hsa-miR-4539

Accession MIMAT0019082
Sequence

39 - 

gcugaacugggcugagcugggc

 - 60

Get sequence
Deep sequencing48 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).