Stem-loop sequence hsa-mir-4538

AccessionMI0016909 (change log)
Symbol HGNC:MIR4538
DescriptionHomo sapiens miR-4538 stem-loop
Literature search

1 open access papers mention hsa-mir-4538
(3 sentences)

Stem-loop
   --g    ug   g  -    g  g    g    g    ga 
5'    agcu  gau ag cugg cu aacu ggcu gguu  g
      ||||  ||| || |||| || |||| |||| ||||   
3'    ucgg  cua uc gacc ga uuga ucgg ucgg  c
   gag    gu   g  a    -  g    g    g    gu 
Get sequence
Deep sequencing
102 reads, 2.78 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 105858165-105858242 [-]
antisense
OTTHUMT00000409220 ; PACS2-014; intron 1
OTTHUMT00000409219 ; PACS2-013; intron 2
OTTHUMT00000409217 ; PACS2-004; intron 6
OTTHUMT00000409215 ; PACS2-005; intron 15
OTTHUMT00000409211 ; PACS2-006; intron 20
OTTHUMT00000409208 ; PACS2-002; intron 21
OTTHUMT00000409209 ; PACS2-003; intron 21
OTTHUMT00000409210 ; PACS2-001; intron 22
ENST00000551801 ; PACS2-014; intron 1
ENST00000548796 ; PACS2-013; intron 2
ENST00000551743 ; PACS2-004; intron 6
ENST00000551692 ; PACS2-005; intron 15
ENST00000547217 ; PACS2-006; intron 20
ENST00000430725 ; PACS2-002; intron 21
ENST00000325438 ; PACS2-003; intron 21
ENST00000447393 ; PACS2-201; intron 21
ENST00000458164 ; PACS2-001; intron 22
Clustered miRNAs
< 10kb from hsa-mir-4538
hsa-mir-4537chr14: 105859484-105859553 [-]
hsa-mir-4538chr14: 105858165-105858242 [-]
hsa-mir-4507chr14: 105858124-105858175 [-]
hsa-mir-4539chr14: 105857513-105857572 [-]
Database links

Mature sequence hsa-miR-4538

Accession MIMAT0019081
Sequence

1 - 

gagcuuggaugagcugggcuga

 - 22

Get sequence
Deep sequencing18 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).