Stem-loop sequence hsa-mir-4537

AccessionMI0016908 (change log)
Symbol HGNC:MIR4537
DescriptionHomo sapiens miR-4537 stem-loop
Stem-loop
   -- g   cg    g         g    g    aa 
5'   u agc  agcu agcuuagcu ggcu agcu  c
     | |||  |||| ||||||||| |||| ||||   
3'   a ucg  ucga ucgggucga ucgg ucgg  c
   cg g   ag    g         g    g    ga 
Get sequence
Deep sequencing
148 reads, 2.38 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 105859484-105859553 [-]
antisense
OTTHUMT00000409221 ; PACS2-012; intron 1
OTTHUMT00000409220 ; PACS2-014; intron 2
OTTHUMT00000409219 ; PACS2-013; intron 3
OTTHUMT00000409217 ; PACS2-004; intron 7
OTTHUMT00000409215 ; PACS2-005; intron 16
OTTHUMT00000409211 ; PACS2-006; intron 21
OTTHUMT00000409208 ; PACS2-002; intron 22
OTTHUMT00000409209 ; PACS2-003; intron 22
OTTHUMT00000409210 ; PACS2-001; intron 23
ENST00000550790 ; PACS2-012; intron 1
ENST00000551801 ; PACS2-014; intron 2
ENST00000548796 ; PACS2-013; intron 3
ENST00000551743 ; PACS2-004; intron 7
ENST00000551692 ; PACS2-005; intron 16
ENST00000547217 ; PACS2-006; intron 21
ENST00000430725 ; PACS2-002; intron 22
ENST00000325438 ; PACS2-003; intron 22
ENST00000447393 ; PACS2-201; intron 22
ENST00000458164 ; PACS2-001; intron 23
Clustered miRNAs
< 10kb from hsa-mir-4537
hsa-mir-4537chr14: 105859484-105859553 [-]
hsa-mir-4538chr14: 105858165-105858242 [-]
hsa-mir-4507chr14: 105858124-105858175 [-]
hsa-mir-4539chr14: 105857513-105857572 [-]
Database links

Mature sequence hsa-miR-4537

Accession MIMAT0019080
Sequence

1 - 

ugagccgagcugagcuuagcug

 - 22

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).