Stem-loop sequence hsa-mir-4536-1

AccessionMI0016906 (change log)
Previous IDshsa-mir-4536
Symbol HGNC:MIR4536-1
DescriptionHomo sapiens miR-4536-1 stem-loop
Gene family MIPF0001319; mir-4536
Stem-loop
                            ------------------    -cu    
5' augugguagauauaugcacgauaua                  uaua   gcc 
   |||||||||||||||||||||||||                  ||||   || c
3' uacaccaucuauauacgugcuauau                  auau   cgu 
                            ccauacauacauacauac    uuu    
Get sequence
Deep sequencing
372 reads, 0 reads per million, 102 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 55451495-55451582 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-4536-1
hsa-mir-4536-1chrX: 55451495-55451582 [-]
hsa-mir-4536-2chrX: 55451495-55451582 [+]
Database links

Mature sequence hsa-miR-4536-5p

Accession MIMAT0019078
Previous IDshsa-miR-4536
Sequence

2 - 

ugugguagauauaugcacgau

 - 22

Get sequence
Deep sequencing395 reads, 76 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-4536-3p

Accession MIMAT0020959
Sequence

68 - 

ucgugcauauaucuaccacau

 - 88

Get sequence
Deep sequencing148 reads, 39 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).