Stem-loop sequence hsa-mir-4533

AccessionMI0016900 (change log)
Symbol HGNC:MIR4533
DescriptionHomo sapiens miR-4533 stem-loop
Stem-loop
   u    au u      -    ugcc        cu  c 
5'  gaga  g ggaagg aggu    ggacgcug  gg u
    ||||  | |||||| ||||    ||||||||  ||  
3'  cucu  c cuuucc uuca    ccugcgac  uc g
   c    cu u      c    ----        cu  c 
Get sequence
Deep sequencing
185 reads, 22.1 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 60478111-60478181 [+]
sense
OTTHUMT00000079965 ; CDH4-001; intron 8
ENST00000543233 ; CDH4-201; intron 7
ENST00000360469 ; CDH4-001; intron 8
Database links

Mature sequence hsa-miR-4533

Accession MIMAT0019072
Sequence

9 - 

uggaaggagguugccggacgcu

 - 30

Get sequence
Deep sequencing31 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).