Stem-loop sequence hsa-mir-4528

AccessionMI0016895 (change log)
Symbol HGNC:MIR4528
DescriptionHomo sapiens miR-4528 stem-loop
Stem-loop
   u         a a  a      uu        -   --       a 
5'  auucuacug g gu cagauc  uauauaua uga  ucauuau u
    ||||||||| | || ||||||  |||||||| |||  |||||||  
3'  uaagaugac c ca gucuag  auguauau acu  aguagua g
   c         c a  g      -u        u   ag       u 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 53237101-53237190 [+]
antisense
OTTHUMT00000421656 ; TCF4-028; intron 1
OTTHUMT00000421629 ; TCF4-008; intron 2
OTTHUMT00000421632 ; TCF4-007; intron 2
OTTHUMT00000421633 ; TCF4-003; intron 2
OTTHUMT00000421635 ; TCF4-005; intron 2
OTTHUMT00000421678 ; TCF4-046; intron 2
OTTHUMT00000421642 ; TCF4-041; intron 2
OTTHUMT00000421649 ; TCF4-027; intron 2
OTTHUMT00000421650 ; TCF4-021; intron 2
OTTHUMT00000421665 ; TCF4-024; intron 2
OTTHUMT00000421657 ; TCF4-026; intron 2
OTTHUMT00000421659 ; TCF4-025; intron 2
OTTHUMT00000421660 ; TCF4-023; intron 2
OTTHUMT00000421662 ; TCF4-029; intron 2
OTTHUMT00000256014 ; TCF4-002; intron 3
OTTHUMT00000421634 ; TCF4-006; intron 3
OTTHUMT00000421628 ; TCF4-001; intron 3
OTTHUMT00000421677 ; TCF4-045; intron 3
OTTHUMT00000421644 ; TCF4-019; intron 3
OTTHUMT00000421661 ; TCF4-040; intron 3
OTTHUMT00000421664 ; TCF4-022; intron 3
OTTHUMT00000256013 ; TCF4-004; intron 4
ENST00000563824 ; TCF4-028; intron 1
ENST00000568673 ; TCF4-008; intron 2
ENST00000540999 ; TCF4-007; intron 2
ENST00000537578 ; TCF4-003; intron 2
ENST00000568740 ; TCF4-005; intron 2
ENST00000567880 ; TCF4-046; intron 2
ENST00000566286 ; TCF4-041; intron 2
ENST00000566514 ; TCF4-027; intron 2
ENST00000568169 ; TCF4-021; intron 2
ENST00000565908 ; TCF4-024; intron 2
ENST00000568147 ; TCF4-026; intron 2
ENST00000563888 ; TCF4-025; intron 2
ENST00000564343 ; TCF4-023; intron 2
ENST00000562847 ; TCF4-029; intron 2
ENST00000356073 ; TCF4-002; intron 3
ENST00000564999 ; TCF4-006; intron 3
ENST00000565018 ; TCF4-001; intron 3
ENST00000566279 ; TCF4-045; intron 3
ENST00000564403 ; TCF4-019; intron 3
ENST00000562543 ; TCF4-040; intron 3
ENST00000569357 ; TCF4-022; intron 3
ENST00000354452 ; TCF4-201; intron 3
ENST00000398339 ; TCF4-004; intron 4
Database links

Mature sequence hsa-miR-4528

Accession MIMAT0019067
Sequence

56 - 

ucauuauauguaugaucuggac

 - 77

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).