Stem-loop sequence hsa-mir-4527

AccessionMI0016894 (change log)
Symbol HGNC:MIR4527
DescriptionHomo sapiens miR-4527 stem-loop
Stem-loop
   c    a    u u   a    a   c    a     
5'  caga gugg c gca agag uga ugug aucc 
    |||| |||| | ||| |||| ||| |||| ||| a
3'  gucu cauc g cgu ucuc acu acac uaga 
   a    a    c u   g    g   -    c     
Get sequence
Deep sequencing
20 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 47380496-47380565 [+]
antisense
OTTHUMT00000448517 ; MYO5B-006; intron 10
OTTHUMT00000448515 ; MYO5B-001; intron 30
ENST00000324581 ; MYO5B-201; intron 9
ENST00000592779 ; MYO5B-006; intron 10
ENST00000285039 ; MYO5B-001; intron 30
Database links

Mature sequence hsa-miR-4527

Accession MIMAT0019066
Sequence

8 - 

uggucugcaaagagaugacugu

 - 29

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).