Stem-loop sequence hsa-mir-4526

AccessionMI0016893 (change log)
Symbol HGNC:MIR4526
DescriptionHomo sapiens miR-4526 stem-loop
Gene family MIPF0001545; mir-4526
Stem-loop
   u        auc  -    c  u           u    --  - g 
5'  gcggugac   ag ggcc ag cccugcuguca gccc  ca g u
    ||||||||   || |||| || ||||||||||| ||||  || |  
3'  ugucacug   uc ccgg uc gggacgacagu cggg  gu c g
   c        caa  g    -  -           -    uc  g a 
Get sequence
Deep sequencing
96 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 13611114-13611200 [+]
sense
OTTHUMT00000458330 ; LDLRAD4-015; intron 2
OTTHUMT00000458326 ; LDLRAD4-002; intron 3
OTTHUMT00000458328 ; LDLRAD4-013; intron 3
OTTHUMT00000458323 ; LDLRAD4-010; intron 4
OTTHUMT00000458325 ; LDLRAD4-001; intron 4
ENST00000583168 ; MIR4526-201; exon 1
ENST00000586207 ; LDLRAD4-015; intron 2
ENST00000359446 ; LDLRAD4-002; intron 3
ENST00000593236 ; LDLRAD4-013; intron 3
ENST00000587905 ; LDLRAD4-010; intron 4
ENST00000399848 ; LDLRAD4-001; intron 4
ENST00000361205 ; LDLRAD4-201; intron 4
Database links

Mature sequence hsa-miR-4526

Accession MIMAT0019065
Sequence

54 - 

gcugacagcagggcuggccgcu

 - 75

Get sequence
Deep sequencing81 reads, 35 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).